고객지원 > FAQ

Sequencing

1.염기서열 분석기간은 얼마나 되나요?
-Basic 샘플의 경우는 통상적으로 24시간이내에 결과를 받아보실수 있습니다.
gel extraction등 부가 서비스를 선택하신 샘플에 대해서는 하루정도 더 소요됩니다.

2. 샘플 준비는 어떻게 해야 하나요?
-plasmid DNA의 경우 한 반응당 100~200ng/ul, PCR product의 경우는 50~100ng/ul를 기본 10ul 정도를 1.5ml tube에 보내주시면 됩니다.
(반응 수량에 따라 추가적으로 보내주시면 됩니다.)

3. Primer는 어떻게 준비하나요?
- specific primer의 경우 10pmole/ul 를 1.5ml tube에 10ul 정도 보내주시면 됩니다.
(반응수가 추가 될때마다 10pmole씩 추가적으로 보내주시면 됩니다.)

4.결과 확인은 어디서 하나요?
-홈페이지의 마이페이지>결과 확인을 통해서 결과를 다운로드 받으실 수 있습니다.

5. ab1파일은 어떻게 확인할 수 있나요?
-별도의 viewer program(chromas , FinchTV)을 통해서 확인 가능합니다.

6. 샘플 보관기간은 어떻게 되나요?
-접수일을 기준으로 2주정도 보관되고 있습니다.

7.데이터 보관 기간은 어떻게 되나요?
-결과 발송일을 기준으로 웹페이지에서 한달 정도 다운로드 가능합니다.

8.제공되는 primer는 어떤 것들이 있나요?
- basic sequencing 하단에 universal primer list를 통해서 무료로 제공되는 프라이머의 이름과 서열을 확인하실 수 있습니다.

9.보유하고 있는 universal primer는 무엇인가요?
Universal primer
No
Primer name
sequence
1
ACYCDuetUP1
GGA TCT CGA CGC TCT CCC T
2
BGH-R
CTA GAA GGC ACA GTC GAG GC
3
CMV24
TAT TAG GAC AAG GCT GGT GGG CAC
4
CMV30
AAT GTC GTA ATA ACC CCG CCC CGT TGA CGC
5
CMV-Forward
CGC AAA TGG GCG GTA GGC GTG
6
DuetDown1
GAT TAT GCG GCC GTG TAC AA
7
DuetUP2
TTG TAC ACG GCC GCA TAA TC
8
EGFP-C
CAT GGT CCT GCT GGA GTT CGT G
9
EGFP-N
CGT CGC CGT CCA GCT CGA CCA G
10
GAL4(-BD)-3
TTT TCG TTT TAA AAC CTA AGA GT
11
GAL4(-BD)-5
TCA TCG GAA GAG AGT AGT
12
GL1
TGT ATC TTA TGG TAC TGT AAC TG
13
GL2
CTT TAT GTT TTT GGC GTC TTC CA
14
M13F(-20)
GTA AAA CGA CGG CCA GT
15
M13F(-40)
GTT TTC CCA GTC ACG AC
16
M13pUC-R
GCG GAT AAC AAT TTC ACA CAG
17
M13R
CAG GAA ACA GCT ATG AC
18
MATCHMAKER3
GTG AAC TTG CGG GGT TTT TCA GTA TCT ACG AT
19
MATCHMAKER5
GAA GAT ACC CCA CCA AAC
20
mCherry-F
CCCCGTAATGCAGAAGAAGA
21
mCherry-R
TTGGTCACCTTCAGCTTGG
22
pBad-F
ATG CCA TAG CAT TTT TAT CC
23
pBad-R
GAT TTA ATC TGT ATC AGG
24
pET-upstream
ATG CGT CCG GCG TAG AGG
25
pFastBac-F
GGA TTA TTC ATA CCG TCC CA
26
pFastBac-R
CAA ATG TGG TAT GGC TGA TT
27
pGEX3
CCG GGA GCT GCA TGT GTC AGA GG
28
pGEX5
GGG CTG GCA AGC CAC GTT TGG TG
29
pJET1.2-F
CGA CTC ACT ATA GGG AGA GCG GC
30
pJET1.2-R
AAG AAC ATC GAT TTT CCA TGG CAG
31
pMAL-F
AAC ATC CCG CAG ATG TCC
32
pMAL-R
CAA GCT GCC ATT CGC CAT
33
pQE-forward
CCC GAA AAG TGC CAC CTG
34
pQE-reverse
GTT CTG AGG TCA TTA CTG G
35
RV3
CTA GCA AAA TAG GCT GTC CC
36
RV4
GAC GAT AGT CAT GCC CCG CG
37
SP6
ATT TAG GTG ACA CTA TAG
38
SV40 pAR
GAA ATT TGT GAT GCT ATT GC
39
T3
CAA TTA ACC CTC ACT AAA
40
T7
TAA TAC GAC TCA CTA TAG GG
41
T7terminator
GCT AGT TAT TGC TCA GCG G
42
U6
CAG TGC AGG GGA AAG AAT AGT AGA C
43
U6pro
GGG CAG GAA GAG GGC CTA T
미생물 동정 관련 primer
세균동정 27F AGA GTT TGA TCM TGG CTC AG
1492R GGT TAC CTT GTT ACG ACT T
518F CCA GCA GCC GCG GTA ATA CG
800R TAC CAG GGT ATC TAA TCC
진균동정 ITS1 TCC GTA GGT GAA CCT GCG G
ITS4 TCC TCC GCT TAT TGA TAT GC
NL1 GCA TAT CAA TAA GCG GAG GAA AAG
NL4 GGT CCG TGT TTC AAG ACG G
LROR ACC CGC TGA ACT TAA GC
LR7 TAC TAC CAC CAA GAT CT
NS1 GTA GTC ATA TGC TTG TCT C
NS8 TCC GCA GGT TCA CCT AC GGA

Oligo

Oligo 접수마감 시간과 배송일은 어떻게 되나요 ?
주문 접수 마감
월요일 ~ 금요일 1차 접수 2차 접수 2-1차 접수 3차 접수
(90mer 이하) (70mer 이하) (60mer 이하) (11시 이후 46 ~ 90mer 주문건 포함)
전일 오후 11시 오전 11시 오전 11시 오후 5시
당일 오전 11시 ~ 오후 2시 ~ 오후 5시 ~ 오후 11시
토요일 일요일 오전 9시 이전 35mer 이하 접수건 월요일 출고
일요일 / 공휴일 월요일 1차 일괄 접수 or 익일 영업일 1차 접수
*PAGE 정제의 경우 3~4영업일이 추가됩니다.

올리고 주문 전에 견적은 어떻게 받을수 있나요?
홈페이지에서 oligo 주문양식을 Download 하셔서 올리고 주문 메일 (oligo@bionicsro.co.kr) 로 보내주시면 됩니다. 성함, 소속, 전화번호 기재를 하시면 보다 빠른 서비스를 받아 보실수 있습니다.
또는 담당 영업사원이나 02-6925-1626 로 문의해주십시오.

최소 및 최대 합성 mer수 및 scale
STANDARD OLIGO(HAP)
Synthesis Scale(nmole) 25nmol 50nmol 200nmol 1umol
mer(=base) 16 - 29mer 4 - 90mer 4 - 130mer 4 - 130mer
* 50mer이상의 oligo 합성의 경우 PAGE 정제를 권장합니다.
* PAGE/HPLC 정제의 경우 추가정제비용이 들어가며 3 ~ 4 영업일이 추가됩니다.
STANDARD OLIGO(PAGE)
Synthesis Scale(nmole) - 50nmol 200nmol 1umol
mer(=base) - 4 - 60mer 4 - 130mer 4 - 130mer
* PAGE 정제의 경우 50nmol 부터 주문 가능합니다.
Guaranteed Yield(OD)
Synthesis Scale(nmole) 25nmol 50nmol 200nmol 1umol
Purification HAP 3 6 9 20
PAGE - 2 4 8
* 25mer 기준 Guaranteed Yield 입니다.
* 주문하신 프라이머 Base 길이가길거나 짧을 경우 제공량이 조정될 수 있습니다.


합성 scale의 차이는 무엇입니까?
합성 scale(0,025umol, 0.05umol, 0.2umol, 1.0umol)은 합성 개시물질(CPG)의 함량으로 최종 올리고 산물의 양은 올리고의 길이, 합성 효율, 염기조성 등에 따라 달라지게 됩니다.

50 nmoles scale로 주문했는데 합성량이 그 보다 적은 이유는?
50 nmole scale 합성은 최종 올리고의 양이 50 nmole 이 된다는 것이 아니라 합성 출발물질의 양을 50 nmole 로 하여 합성을 시작한다는 것을 의미합니다. 따라서 합성 및 정제된 최종 올리고의 양은 올리고의 길이, 합성효율(coupling efficiency, 보통 >98%), 염기조성 등에 따라 변하게 됩니다.

HAP 정제란?
HAP(Hig Affinity Purification)는 Bionics와 Biobasic의 기본 정제방법으로 HAP Column의 high affinity resin을 통해 n-1, n-2, …mer을 제거하여 고순도의 oligo을 얻는 정제방법입니다. HAP 정제는 모든 oligo 정제에 기본사양으로 무료 제공됩니다.

HPLC 정제란?
HPLC(High-performance liquid chromatography)는 Reverse Phase Column을 통과시켜 합성 된 올리고의 Hydrophobic한 성질을 이용하여 major oligo를 분리해 내는 방법입니다. 5-59 bases의 short oligo, 또는 Modified Oligo에 적합한 고순도 정제 방법으로 정제 과정상의 Oligo유실로 최종 수득률은 다소 감소하게 됩니다. 최소 0.1scale부터 합성이 가능하며, scale에 따라 추가적인 정제 비용이 발생합니다. 배송 소요일도 대략 7일정도 소요됩니다.

PAGE 정제란?
PAGE(polyacrylamide gel electrophoresis)는 Polyacrylamide gel에 합성된 Oligo를 전기영동하여 분리된 major oligo만을 추출하는 고순도 정제방법입니다. >60 base의 long oligo 정제에 적합하며, 130mer까지 진행이 가능합니다. 0.05scale부터 합성이 가능하며, scale에 따라 추가적인 정제 비용이 발생합니다. 3영업일이 더 소요됩니다.

Oligo 사용법 및 보관 방법
Oligo 는 일반적으로 Dry 된 형태로 공급됩니다.처음 올리고를 받으시고 뚜껑을 여시기 전 먼저 Centrifuge 에 잠시 돌리신 후 뚜껑을 열어주십시오. 제품을 수령하신 후 용기에 기재된 양의 TE buffer (10 mM Tri-HCl pH8.0, 1 mM EDTA) 또는 멸균증류수에 녹여 100 uM stock 상태로 -20℃이하에 보관하시고, 사용시 적정 농도로 희석하여 사용하시기를 권장합니다. 용액상태로 보관할 때에는 멸균증류수에 녹이는 것보다 TE (10mM Tri-HCl (pH8.0), 0.1mM EDTA) Buffer 에 녹여두시면 더 오래 보관할 수 있습니다. 만약 올리고가 잘 녹지 않을 경우 60~70℃ water bath 에 10~15 분간 incubation 시킨 후 vortex 하여 centrifuge 후에 사용하시기 바랍니다.

합성된 올리고의 농도 맞추는 방법에 대한설명
올리고 리포트용지에 쓰여있는 To make 100 μM stock ' 라는 말은 100μM 의 농도로 만들기 위해 첨가해야 할 TE buffer 나 D.W 의 양을 이야기 합니다. 받으신 리포트용지에 각각 189.0 과 209.2 라고 적혔다면, 각 oligomer tube 에 적힌 대로 각각 D.W를 189.0 ul 와 209.2 ul 를 각각 첨가했을 때 농도가 100 μM 가 된다는 것입니다.

동결건조상태
Oligo는 일반적으로 투명한 모양으로 마르지만 합성된 Oligo의 양이나 동결조건에 따라 하얀 눈꽃송이처럼 마르는 경우도 있으며, 이는 정상적으로 잘 건조된 경우이므로 안심하시고 사용하셔도 됩니다. 또한, 육안으로 보았을 때 덜 마른 것처럼 보일 수도 있으나 출하 전 검수 후에 보내드린 Oligo이므로 사용하셔도 됩니다.


uM pmole/ul농도로 환산
시트지에 표기된 To make 100 μM stock은 To make 100 pmole/uM 같은단위입니다. Oligomer의 기본농도는 M (mole/L) 이고, 경우에 따라서 그 앞에 붙는 u(micro), n (nano), p (pico) 등의 첨자들은 M을 보조하는 단위들입니다. 아래표를 참고하시면,
10-1 = deci[d],101 =deca[da] 10-2 =centi[c],102 = hecto[h] 10-3 =milli[m],103 = kilo[K] 10-6 =micro [u], 106 = mega [M] 10-9 = nano[n], 109 = giga[G] 10-12 = pico[p], 1012 = tera[T] 10-15 = femto[f], 1015 = peta[P]
1 pmole/ul = 1x10-12 mole / 1x10-6 L = 1x10-6 mole / L = 1 umole/ L = 1 uM 이므로, uM과 pmole/ul는 같은 단위가 됩니다.

Oligo의 Q/C는 어떤 방법으로 진행되나요?

Oligo의 품질보증을 위해 합성된 모든 Oligo의 흡광도 와 ESI-MS 분석을 통하여 QC 진행 합니다.

주문한 Oligo에 대한 Q/C 결과 정보는 어떻게 알 수 있나요?
마이페이지-올리고 주문내역-Mass보기 를 누르시면 확인하실수있습니다.
Oligo name, sequence, Tm값, OD, LC(liquid chromatography)mass Q/C 결과 등 자세한 정보가 기입되어 있습니다.

modification 주문하는 방법

1. 주문할 oligo 정보를 기재한다.
2.생산기간을 Nextweek로 설정한후 Purification, scale및 Modification 을 선택한다.
* modification 주문은 대략 7일 정도 소요되므로 생산기간을 NextWeek로 해주셔야 합니다.
* HPLC주문은 100n Scale 부터 주문 가능합니다.


동일한 Oligo를 다시 주문하는 방법

Login -마이페이지-올리고주문내역-주문번호-재주문을 클릭하시면 됩니다.

Cloning

진행 완료 후 납품시 어떤 것들을 받을 수 있습니까?
최초 의뢰시 보내주신 vector, template DNA, 제작한 primer set, 완성된 clone, 이에 대한 cell stock이 납품됩니다. 또한, 실험 관련 data와 sequencing 결과는 e-mail을 통하여 전송됩니다.

납품 진행시 보내주는 plasmid DNA의 양은 어느 정도나 됩니까?
일반적으로 screening이 완료된 후 miniprep을 진행하게 되며, 이를 이용하여 sequencing을 진행하며, 그 후 남은 sample을 고객에게 전달해 드립니다.
보통 20ul 정도의 양이며, 이는 transfection과 같은 실험에 바로 사용하기에 quality에서 무리가 있습니다.
함께 보내드리는 cell stock을 이용하여 새로 prep을 진행하시거나 maxiprep을 의뢰하시면 됩니다.
Maxiprep service는 transfection ready 상태로 납품됩니다. 비용은 건당 10만원이며 기간은 1주일이 소요됩니다.
Macherey Nagel사의 Nucleobond Maxi kit을 사용하여 100ug 이상의 DNA를 제공하게 됩니다.
최소 보장량이 100ug이며, 일반적으로 200~300ug의 DNA를 얻을 수 있습니다.

납품되어진 cell stock이 자라질 않습니다.
cell stock은 항상 -70 ℃ 보관이 원칙입니다. 하지만 배송과정이나 보관과정에서 반복적인 동결 및 해동으로 cell이 죽는 경우가 종종 발생합니다.
이 경우 납품 완료 후 3개월간은 새로운 cell stock을 제공해드리지만 그 이상의 시간이 경과된 경우 책임지지 않습니다.
최초 납품시 바로 접종하셔서 stock을 다시 만드는 것을 추천드립니다.

진행 완료 메일을 받았는데 납품이 이뤄지지 않고 있습니다.
메일을 보내드린 후 답신을 받아야만 납품이 진행됩니다. 정확히 주문하신 고객에게 전달하는 것이 원칙이기 때문에 답변을 주시면 원하시는 날짜에 배송하여 드립니다.
답신을 얻지 못하는 경우 그만큼 납품에 지연이 생길 수 있으니 빠른 답신 부탁드립니다.

cloning에 대하여 아무런 지식이 없습니다. 이에 대한 상담이 가능합니까?
사용하실 vector, insert정보 및 detection에 사용하실 tag 정도만 지정해주시면 당사 cloning팀에서 모든 design 및 진행이 가능하므로 전혀 걱정하시지 않으셔도 됩니다.
Primer design 및 실험계획이 완료되면 이를 고객께 전송해 드리며, 실험진행에서 발생한 모든 data도 개조식으로 정리하여 보고드리고 있습니다.
이를 연구회 발표 및 논문 작성에 이용하실 수 있습니다. 단, 실험방법 및 결과를 연구보고서 또는 논문 투고 목적의 서술형 보고서는 작성해 드리지 않습니다.

사용할 vector상의 제한효소 site가 insert에 모두 존재합니다. 이 경우에도 진행이 가능합니까?
일반적으로 사용하는 제한효소를 사용한 digestion & ligation 방법 외에 당사에서는 vector와 insert의 공통서열을 이용한 recombination을 이용한 방법으로, 이 방법을 사용했을 때에는 insert 내에 해당 제한효소 site가 있어도 전혀 문제없이 cloning이 가능합니다.
이 부분은 걱정마시고 의뢰하시면 됩니다.

복잡한 방법을 통하여 여러 sequence를 이어붙이고 싶은데 가능한가요?
overlap PCR을 통하여 chimeric gene의 제작이 가능합니다. 최소 2개의 fragment에서 10개 이상의 fragment도 하나의 gene으로 제작이 가능하며, 이 경우 추가적인 비용이 발생합니다.
정확한 실험내용을 주시면 견적을 제공해 드립니다.

완성된 clone을 이용하여 추가적으로 제공 가능한 실험이 어떤 것들이 있습니까?
Maxiprep, 단백질 발현조건 확인 및 정제, in vitro transcription, linearization, 특정 strain에 transformation 등을 제공해드립니다.
고객님께서 추가적으로 원하는 것이 있으면 cloning 팀과의 상담을 통하여 가능여부를 판단하여 드립니다.

Cloning 의뢰시 보내드려야하는 sample의 양은 얼마나 필요한지요?
sample의 종류에 따라 조금씩 다릅니다.
Plasmid DNA or E. coli cell stock : 1ug 이상, 당사에서 amplify 가능합니다.
PCR product : 50ul reaction 1 tube
Genomic DNA, cDNA 및 total RNA : 10ug 이상, 이는 PCR optimize를 위해 필요한 양입니다.
배양세포 및 조직 : 별도 문의

위의 기준으로 제공해주시면 가능합니다.