서비스 >      DNA Sequencing
바이오닉스의 Sequencing service는 sanger method를 기반으로
High throughput DNA Analyzer를 이용하여 염기서열 서비스를 제공합니다.

·신속, 정확한 서비스 제공 : 샘플 접수 후 24hr 이내 결과 발송 및 문자 알림 서비스
·무료 universal primer 제공
·oligo synthesis 서비스와 연계하여 빠른 결과 제공
·Long Read Length (~700bp)
·무료 결과 분석

DNA SEQUENCING Work Flow
주문접수 &샘플 수거 홈페이지를 통한 분석 의뢰서 등록
서울 경기일부, 대전 직접수거
그외 지역: 택배 및 우편접수
샘플 확인 수거된 샘플은 전기영동을 통해 농도 확인
(샘플 보관기간 : 2주)
SEQUENCING Bigdye Terminator v3.1Cycle Sequencing Kit을 이용한 PCR 진행
Bead방식을 통한 clean-up
Applied Biosystems 3730XL DNA Analyzer를 통한 running
결과 발송 홈페이지를 통한 결과 전달
SMS 문자발송
(Data 보관기간 : 1개월)
Basic Sequcing
가장 기본적인 서비스로 보내주신 DNA를 요청하신 PRIMER를 이용하여 분석하는 서비스
샘플 준비
Sample 종류 Concentration Volume 비고
plasmid 100~200ng/ul 10ul vector name 기재 요청
PCR product(Purified) 50ng~/ul 10ul size기재 요청
PCR product(Non-Purified) 50ng~/ul 20ul~ size기재 요청
***1rxn기준임
프라이머 준비
primer Concentration Volume 비고
specific primer 5 or 10pmole/ul 10ul primer마다 각기 1.5ml tube에 준비
농도 기재 요청
Universal primer 당사제공
(제공 primer list에 없는 프라이머는 반드시 별도 동봉)
***1rxn기준임
프라이머 보관 가이드라인
최소기준 비고
concentration Volume
5pmol 100ul -최소 주 2회 이상 해당 primer 사용(총 반응수와 관계없이 사용 빈도가 중요)
-Stock 보관도 가능하나 stock의 degradation에 대해서는 책임지지 않음
-보관 요청한 primer 내역은 보통 1~3일 이내 확인 가능
-시퀀싱 주문 창에서 바로 해당 primer 확인 가능
Universal primer
No Primer name sequence
1 ACYCDuetUP1 GGA TCT CGA CGC TCT CCC T
2 BGH-R CTA GAA GGC ACA GTC GAG GC
3 CMV24 TAT TAG GAC AAG GCT GGT GGG CAC
4 CMV30 AAT GTC GTA ATA ACC CCG CCC CGT TGA CGC
5 CMV-Forward CGC AAA TGG GCG GTA GGC GTG
6 DuetDown1 GAT TAT GCG GCC GTG TAC AA
7 DuetUP2 TTG TAC ACG GCC GCA TAA TC
8 EGFP-C CAT GGT CCT GCT GGA GTT CGT G
9 EGFP-N CGT CGC CGT CCA GCT CGA CCA G
10 GAL4(-BD)-3 TTT TCG TTT TAA AAC CTA AGA GT
11 GAL4(-BD)-5 TCA TCG GAA GAG AGT AGT
12 GL1 TGT ATC TTA TGG TAC TGT AAC TG
13 GL2 CTT TAT GTT TTT GGC GTC TTC CA
14 M13F(-20) GTA AAA CGA CGG CCA GT
15 M13F(-40) GTT TTC CCA GTC ACG AC
16 M13pUC-R GCG GAT AAC AAT TTC ACA CAG
17 M13R CAG GAA ACA GCT ATG AC
18 MATCHMAKER3 GTG AAC TTG CGG GGT TTT TCA GTA TCT ACG AT
19 MATCHMAKER5 GAA GAT ACC CCA CCA AAC
20 mCherry-F CCCCGTAATGCAGAAGAAGA
21 mCherry-R TTGGTCACCTTCAGCTTGG
22 pBad-F ATG CCA TAG CAT TTT TAT CC
23 pBad-R GAT TTA ATC TGT ATC AGG
24 pET-upstream ATG CGT CCG GCG TAG AGG
25 pFastBac-F GGA TTA TTC ATA CCG TCC CA
26 pFastBac-R CAA ATG TGG TAT GGC TGA TT
27 pGEX3 CCG GGA GCT GCA TGT GTC AGA GG
28 pGEX5 GGG CTG GCA AGC CAC GTT TGG TG
29 pJET1.2-F CGA CTC ACT ATA GGG AGA GCG GC
30 pJET1.2-R AAG AAC ATC GAT TTT CCA TGG CAG
31 pMAL-F AAC ATC CCG CAG ATG TCC
32 pMAL-R CAA GCT GCC ATT CGC CAT
33 pQE-forward CCC GAA AAG TGC CAC CTG
34 pQE-reverse GTT CTG AGG TCA TTA CTG G
35 RV3 CTA GCA AAA TAG GCT GTC CC
36 RV4 GAC GAT AGT CAT GCC CCG CG
37 SP6 ATT TAG GTG ACA CTA TAG
38 SV40 pAR GAA ATT TGT GAT GCT ATT GC
39 T3 CAA TTA ACC CTC ACT AAA
40 T7 TAA TAC GAC TCA CTA TAG GG
41 T7terminator GCT AGT TAT TGC TCA GCG G
42 U6 CAG TGC AGG GGA AAG AAT AGT AGA C
43 U6pro GGG CAG GAA GAG GGC CTA T
미생물 동정 관련 primer
세균동정 27F AGA GTT TGA TCM TGG CTC AG
1492R GGT TAC CTT GTT ACG ACT T
518F CCA GCA GCC GCG GTA ATA CG
800R TAC CAG GGT ATC TAA TCC
진균동정 ITS1 TCC GTA GGT GAA CCT GCG G
ITS4 TCC TCC GCT TAT TGA TAT GC
NL1 GCA TAT CAA TAA GCG GAG GAA AAG
NL4 GGT CCG TGT TTC AAG ACG G
LROR ACC CGC TGA ACT TAA GC
LR7 TAC TAC CAC CAA GAT CT
NS1 GTA GTC ATA TGC TTG TCT C
NS8 TCC GCA GGT TCA CCT AC GGA
세균 혹은 진균의 gene 일부를 PCR로 증폭한 후 염기서열을 분석하는 서비스

샘플 준비
순수 배양한 colony 형태( bacteria, Yeast)
genomic DNA

분석과정
genomic DNA Extraction Chelex bead를 사용하여 boiling
PCR gene specific primer를 사용한 PCR 증폭
PCR Clean-up Exo/rap 을 이용한 PCR Purification 진행
세균동정
Bacteria gDNA를 이용하여 16s rRNA PCR 진행 (27F-1492R)
약 1.5kb의 PCR product가 생성되며 이를 정제후 sequencing을 진행
요청에 따라inernal primer로 추가 분석 가능

진균동정
Unknown
세가지 specific primer를 이용하여 PCR 진행
(27F+1492R/ITS1+ITS4/NL1+NL4)
Full sequencing
-Single Primer로 한번에 분석할 수 없는 DNA를 Primer walking 방법을 통하여 원하는 size만큼 분석하는 서비스
-primer design,primer synthesis,sequencing analysis,assemly의 일련의 과정을 포함함
-분석 소요시간은 walking size에 따라 달라지며, reference sequence 제공시 소요시간이 단축 됩니다.
-walking primer, sequencing raw data alignment file를 제공


Viral genome sequencing
- reference sequence를 기반으로 제작된 primer set을 이용한 full sequencing service의 제공
- RACE PCR을 이용한 말단부의 서열분석 가능
Mitochondrial genome sequencing
- mtDNA에 대한 full sequencing 서비스를 제공
- COX1 분석 및 근연종의 서열을 이용한 degenerate PCR을 이용하며, 확인된 최종 서열에 대한 annotation 결과 제공
Bisulfite sequencing
- 염기서열상의 CpG methylation 여부를 확인
- Sequencing을 이용한 methylation 확인 및 TA-cloning을 통한 빈도의 확인이 가능
RACE PCR & Sequencing
- 기지서열을 이용하여 target RNA에 대한 미지의 서열 분석을 진행
- mRNA뿐 아니라 lncRNA, viral RNA의 서열 분석도 가능
Fragment analysis
PCR product의 size를 Applied Biosystems사의 3730xl DNA analyzer장비를 사용하여 오차범위 1~2 bp내로 정확히 분석해 드리는 서비스로 genotyping, DNA profiling등의 다양한 분야에 활용되고 있는 분석방법 입니다.
분석 절차
PCR
형광 dye가 표지된 primer를 이용하여 target region을 포함하여 PCR 수행
Capillary (Electrophoresis)
형광 dye가 표지된 PCR product를 3730xl DNA Analyzer를 이용하여 size 별로 분리
Size 분석
검출된 형광 peak의 size를 Gene Mapper프로그램을 이용하여 분석
적용 분야
- Microstellite/STR을 이용한 genotyping
- Genotype marker 개발
- Amplified Fragment length Polymorphism(AFLP)를 이용한 genotyping 등
Description 기준에 따른 Troubleshooting
1. 반응안됨
Peak이 매우 불규칙적으로 보이며 원하는 DNA의 sequence와 상관이 없는 sequence가 보인다.
원인: Quality가 매우 낮은 sample로 반응 진행 시
DNA와 matching이 되지 않는 primer 사용 시
해결방안: DNA 의 Quality를 높인다.
(purification을 진행하거나, DNA의 농도가 낮은 경우 DNA의 농도를 높여준다.)
DNA에서 primer가 Binding이 되는지 확인한다.

2. Noisy 불규칙적인 작은 Peak이 base line에 보이며, main peak을 확실히 구분하기 어렵도록 noisy 하게 보인다.
원인: DNA의 농도가 기준하는 수치에비해 너무 낮거나, 과량의 DNA로 반응이 진행된 경우
Primer의 반응성이 저해된 경우 이거나(degradation이 되었거나 Tm 값이 맞지 않는 경우)
primer의 농도가 너무 낮을 경우
해결방안: 적정 농도의 DNA와 primer를 사용하여 반응을 진행
Stock primer를 다시 dilution하여 진행하거나, Tm 값이 50~58℃정도가 되도록
design하여 반응 진행

3. Blob 70bp~90bp 사이와 120bp 근처에 2~3개의 peak이 비정상적으로 크게 보이는 현상이다.
(주로 C peak이 먼저 나타남)
원인: DNA의 농도가 너무 낮을 경우 (signal strength가 낮아서 보일 수 있다.)
Sequencing PCR 진행 이후 정제 과정에서 소량 남아있는 Big Dye로 인해
큰 dye blob peaks으로 보이는 경우.
해결방안: DNA의 농도를 측정하여 반응 진행 시 적정량의 DNA를 사용한다.

4. Mix 두 개 이상의 서로 다른 Peak이 겹쳐 보이는 현상
원인: Plasmid 의 경우(첫 번째 이미지 참고)
Insert가 시작 되는 부근에서 mixed bace가 시작되는 경우가 대부분으로,
insert contamination 일 경우 나타난다. PCR product의 경우(두세 번째 이미지 참고)
두 가지 이상의 다른 DNA가 섞여 있거나 한 가지 DNA에 여러 개의 primer binding site가
존재할 경우 나타난다.
해결방안: DNA의 농도를 측정하여 반응 진행 시 적정량의 DNA를 사용한다.

5. 짧게분석 & 분석저해 Guarantee 범위 이전에 signal이 끊어져 읽히지 않은 경우(짧은 DNA제외)
원인: 샘플의 농도가 기준치보다 낮을 경우(권장농도: 150~200ng/ul) / 첫번째 사진 참고
Poly sequence, repeat seq, G-C rich, Short hair pin 구조…등
DNA 특성상 나타나는 분석 저해 / 2~4 번째 사진 참고
해결방안: 시료의 각 ul당 농도를 높여 진행하거나,
반응 진행시 더 많은 양의 DNA로 sequencing용 PCR진행
G-C rich, Short hair pin 구조가 포함된 DNA의 경우
difficult sequencing을 진행하여 현상을 완화시킬 수 있으나, 100%의 성공률은 아니다.
Poly sequence, repeat sequence의 경우 반대쪽으로 읽을 수 있는 primer를 사용하여
확인할 수 있으나, 동일 구간에서 같응 양상이 나타날 수 있다.

6. Re-running
1)pull up peak Data초반의 signal이 강하게 나타나서 peak과 peak사이에 비특이적인 작은peak이 보여
main signal을 방해하는 양상
원인: 과량의 DNA가 들어갔을 경우 주로 Size가 작은 pcr product에서 나타남
해결방안: Running전의 최종 시료를 dilution하여 다시 running하면 깨끗한 결과를 얻을 수 있다.

2) Broad peak Data 중간에 일부 혹은 특정부분 이후에 peak이 퍼져보이는 현상
원인: 기기running시 polymer에 의해 나타나는 양상
해결방안: Running을 다시 한 번 하면 깨끗한 결과를 얻을 수 있다.

3) Spike peak Data 중간 한 부분에, 모든 종류의 peak이 한꺼번에 비정상 적으로 튀는 현상
원인: 기기 running시 capillary 끼어든 air bobble에 의해 나타나는 양상
해결방안: Running을 다시 한 번 하면 깨끗한 결과를 얻을 수 있다.
서비스 가격
no 품목 단가 비고
1 Basic Sequencing 6500
2 Difficult sequencing 10000
3 Full sequencing 50000 kb당 가격
4 Mini prep 3000
5 PCR purification 2000
6 Gel extraction 3000
7 Microbial ID(1rxn) 10000
8 Microbial ID(2rxn) 15000
9 Microbial ID(23s) 25000
10 Microbial ID(unknown) 25000
11 Genomic DNA extraction 10000~ 샘플에 따라서 전처리 비용 추가 발생
12 gDNA prep 5000 Microbial identification의 경우
13 Pre-reacted running 3000 bigdye teminator v3.1만 가능
14 PCR 3000
15 Data 분석료
16 PCR set-up charge 5000 PCR fail시에 요금 부과
17 Align 1000 2개의 partial data assembly의 경우